MADH7 (SMAD7) Human qPCR Primer Pair (NM_005904)
CNY 1140.00
| Cited in 4 publications. |
Product images
CNY 5488.00
CNY 2710.00
CNY 3990.00
CNY 3990.00
CNY 5856.00
Specifications
| Product Data | |
| Gene ID | 4092 |
| Forward Sequence | TGTCCAGATGCTGTGCCTTCCT |
| Reverse Sequence | CTCGTCTTCTCCTCCCAGTATG |
| Synonyms | CRCS3; MADH7; MADH8 |
| Quality Control | The primer mix has been tested to generate satisfactory qPCR data on ABI 7900HT by using the following PCR program: Stage 1: Activation: 50 °C for 2 min; Stage 2: pre-soak:95 °C for 10 min; Stage 3: Denaturation: 95 °C for 15 sec, Annealing: 60°C for 1 min; Stage 4: Melting curve: 95°C for 15 sec, 60°C for 15 sec, 95°C for 15 sec. |
| Storage & Stability | Store at -20°C. |
Citations (4)
| The use of this Gene Expression has been cited in the following citations: |
|---|
|
SET9-Mediated Regulation of TGF-β Signaling Links Protein Methylation to Pulmonary Fibrosis
,null,
Cell Reports
,PubMed ID 27292644
[SMAD7]
|
|
MicroRNA-153 is a prognostic marker and inhibits cell migration and invasion by targeting SNAI1 in human pancreatic ductal adenocarcinoma
,null,
Oncology Reports
,PubMed ID 26062664
[SMAD7]
|
|
MicroRNA-520g induces epithelial-mesenchymal transition and promotes metastasis of hepatocellular carcinoma by targeting SMAD7
,Kan, H;Guo, W;Huang, Y;Liu, D;,
FEBS Lett.
,PubMed ID 25436421
[SMAD7]
|
|
Overexpression of Sulf2 in idiopathic pulmonary fibrosis
,Xinping Yue, Jingning Lu, Linda Auduong, Mark D Sides, and Joseph A Lasky,
Glycobiology, Jun 2013; 23: 709 - 719.
,PubMed ID 23418199
[Smad7]
|
Documents
| FAQs |
Resources
| 基因表达相关资源 |
