Glucose Transporter GLUT1 (SLC2A1) Human qPCR Primer Pair (NM_006516)
CNY 1140.00
| Cited in 6 publications. | 
Product images
 
                    
                
                                                
                                                
                                                
                                                    CNY 3656.00 
                                                    
                                                    CNY 3990.00
                                                
                                            
CNY 2710.00
Specifications
| Product Data | |
| Gene ID | 6513 | 
| Forward Sequence | TTGCAGGCTTCTCCAACTGGAC | 
| Reverse Sequence | CAGAACCAGGAGCACAGTGAAG | 
| Synonyms | CSE; DYT9; DYT17; DYT18; EIG12; GLUT; GLUT-1; GLUT1; GLUT1DS; HTLVR; PED; SDCHCN | 
| Quality Control | The primer mix has been tested to generate satisfactory qPCR data on ABI 7900HT by using the following PCR program: Stage 1: Activation: 50 °C for 2 min; Stage 2: pre-soak:95 °C for 10 min; Stage 3: Denaturation: 95 °C for 15 sec, Annealing: 60°C for 1 min; Stage 4: Melting curve: 95°C for 15 sec, 60°C for 15 sec, 95°C for 15 sec. | 
| Storage & Stability | Store at -20°C. | 
Citations (6)
| The use of this Gene Expression has been cited in the following citations: | 
|---|
| Molecular Aspects of Hypoxic Stress Effects in Chronic Ethanol Exposure of Neuronal Cells
                                                ,null,
                                                Current Issues in Molecular Biology
                                                ,PubMed ID 36826052
                                                [SLC2A1] | 
| Distinct Local and Systemic Molecular Signatures in the Esophageal and Gastric Cancers: Possible Therapy Targets and Biomarkers for Gastric Cancer
                                                ,Bednarz-Misa, I;Fortuna, P;Diakowska, D;Jamrozik, N;Krzystek-Korpacka, M;,
                                                Int J Mol Sci
                                                ,PubMed ID 32630408
                                                [SLC2A1] | 
| Vorinostat suppresses hypoxia signaling by modulating nuclear translocation of hypoxia inducible factor 1 alpha
                                                ,null,
                                                Oncotarget
                                                ,PubMed ID 28915577
                                                [SLC2A1] | 
| Vorinostat suppresses hypoxia signaling by modulating nuclear translocation of hypoxia inducible factor 1 alpha
                                                ,Zhang, C;Yang, C;Feldman, MJ;Wang, H;Pang, Y;Maggio, DM;Zhu, D;Nesvick, CL;Dmitriev, P;Bullova, P;Chittiboina, P;Brady, RO;Pacak, K;Zhuang, Z;,
                                                Oncotarget
                                                ,PubMed ID 28611287
                                                [SLC2A1] | 
| Anthracyclines suppress pheochromocytoma cell characteristics, including metastasis, through inhibition of the hypoxia signaling pathway
                                                ,Pang, Y;Yang, C;Schovanek, J;Wang, H;Bullova, P;Caisova, V;Gupta, G;Wolf, KI;Semenza, GL;Zhuang, Z;Pacak, K;,
                                                Oncotarget
                                                ,PubMed ID 28423608
                                                [SLC2A1] | 
| Somatic HIF2α gain-of-function mutations in paraganglioma and somatostatinoma associated with polycythemia
                                                ,null,
                                                The New England journal of medicine
                                                ,PubMed ID 22931260
                                                [SLC2A1] | 
Documents
| FAQs | 
Resources
| 基因表达相关资源 | 

 
        