Sperm Flagellar 2 (SPEF2) Human qPCR Primer Pair (NM_024867)
CNY 1140.00
| Cited in 23 publications. |
Product images
CNY 2710.00
CNY 3832.00
CNY 4560.00
Specifications
| Product Data | |
| Gene ID | 79925 |
| Forward Sequence | GGAAGAAAGGTGAGACCGCACT |
| Reverse Sequence | TAGGTGGCTGTGGCACTATTGC |
| Synonyms | CT122; KPL2; SPGF43 |
| Quality Control | The primer mix has been tested to generate satisfactory qPCR data on ABI 7900HT by using the following PCR program: Stage 1: Activation: 50 °C for 2 min; Stage 2: pre-soak:95 °C for 10 min; Stage 3: Denaturation: 95 °C for 15 sec, Annealing: 60°C for 1 min; Stage 4: Melting curve: 95°C for 15 sec, 60°C for 15 sec, 95°C for 15 sec. |
| Storage & Stability | Store at -20°C. |
Citations (23)
| The use of this Gene Expression has been cited in the following citations: |
|---|
|
Effect of Recombinant Human Erythroferrone Protein on Hepcidin Gene (Hamp1) Expression in HepG2 and HuH7 Cells
,null,
Materials
,PubMed ID 34772005
[SPEF2]
|
|
Bi-allelic Missense Pathogenic Variants in TRIP13 Cause Female Infertility Characterized by Oocyte Maturation Arrest
,null,
American Journal of Human Genetics
,PubMed ID 32473092
[SPEF2]
|
|
Genes adapt to outsmart gene-targeting strategies in mutant mouse strains by skipping exons to reinitiate transcription and translation
,null,
Genome Biology
,PubMed ID 32646486
[SPEF2]
|
|
Mitochondrial NIX Promotes Tumor Survival in the Hypoxic Niche of Glioblastoma
,null,
Cancer research
,PubMed ID 31488423
[SPEF2]
|
|
DHX15 Is a Coreceptor for RLR Signaling That Promotes Antiviral Defense Against RNA Virus Infection
,null,
Journal of Interferon & Cytokine Research
,PubMed ID 31090472
[SPEF2]
|
|
LncRNAs-directed PTEN enzymatic switch governs epithelial–mesenchymal transition
,null,
Cell Research
,PubMed ID 30631154
[SPEF2]
|
|
Angiomotin-Like 1 Links Paramyxovirus M Proteins to NEDD4 Family Ubiquitin Ligases
,null,
Viruses
,PubMed ID 30708959
[SPEF2]
|
|
Genome-wide analyses identify a role for SLC17A4 and AADAT in thyroid hormone regulation
,null,
Nature Communications
,PubMed ID 30367059
[SPEF2]
|
|
Homozygous Mutations in WEE2 Cause Fertilization Failure and Female Infertility
,null,
American Journal of Human Genetics
,PubMed ID 29606300
[SPEF2]
|
|
Biallelic Mutations in PATL2 Cause Female Infertility Characterized by Oocyte Maturation Arrest
,null,
American Journal of Human Genetics
,PubMed ID 28965849
[SPEF2]
|
|
Mutations in the Transmembrane Domain and Cytoplasmic Tail of Hendra Virus Fusion Protein Disrupt Virus-Like-Particle Assembly
,null,
Journal of Virology
,PubMed ID 28468881
[SPEF2]
|
|
A functional variant in NEPH3 gene confers high risk of renal failure in primary hematuric glomerulopathies. Evidence for predisposition to microalbuminuria in the general population
,null,
PLoS ONE
,PubMed ID 28334007
[SPEF2]
|
|
Identification of Phosphorylation Consensus Sequences and Endogenous Neuronal Substrates of the Psychiatric Risk Kinase TNIK.
,null,
The Journal of pharmacology and experimental therapeutics
,PubMed ID 26645429
[SPEF2]
|
|
TRIM21 Promotes cGAS and RIG-I Sensing of Viral Genomes during Infection by Antibody-Opsonized Virus
,null,
PLoS Pathogens
,PubMed ID 26506431
[SPEF2]
|
|
SIRT6 Deficiency Culminates in Low-Turnover Osteopenia
,null,
Bone
,PubMed ID 26189760
[SPEF2]
|
|
Borna disease virus possesses an NF-ĸB inhibitory sequence in the nucleoprotein gene
,null,
Scientific Reports
,PubMed ID 25733193
[SPEF2]
|
|
CSN-associated USP48 confers stability to nuclear NF-κB/RelA by trimming K48-linked Ub-chains.
,null,
Biochimica et biophysica acta
,PubMed ID 25486460
[SPEF2]
|
|
Disruption of hSWI/SNF complexes in T cells by WAS mutations distinguishes X-linked thrombocytopenia from Wiskott-Aldrich syndrome
,null,
Blood
,PubMed ID 25253772
[SPEF2]
|
|
,null,
Molecular Pharmacology
,PubMed ID 23536728
[SPEF2]
|
|
DIRAS3 regulates the autophagosome initiation complex in dormant ovarian cancer cells
,null,
Autophagy
,PubMed ID 24879154
[SPEF2]
|
|
Negative Regulation of the RalGAP Complex by 14-3-3 *
,null,
The Journal of Biological Chemistry
,PubMed ID 23386617
[SPEF2]
|
|
Oligodendrocyte dysfunction in the pathogenesis of amyotrophic lateral sclerosis
,null,
Brain
,PubMed ID 23378219
[SPEF2]
|
|
snRNA 3? End Formation Requires Heterodimeric Association of Integrator Subunits
,null,
Molecular and Cellular Biology
,PubMed ID 22252320
[SPEF2]
|
Documents
| FAQs |
Resources
| 基因表达相关资源 |
