RUNX2 Human qPCR Primer Pair (NM_004348)
CNY 1140.00
| Cited in 5 publications. | 
Product images
 
                    
                
                                                
                                                
                                                
                                                    CNY 1999.00 
                                                    
                                                    CNY 3600.00
                                                
                                            
CNY 6576.00
CNY 2710.00
                                                
                                                
                                                
                                                    CNY 3776.00 
                                                    
                                                    CNY 5040.00
                                                
                                            
CNY 5856.00
CNY 5488.00
Specifications
| Product Data | |
| Gene ID | 860 | 
| Forward Sequence | CCCAGTATGAGAGTAGGTGTCC | 
| Reverse Sequence | GGGTAAGACTGGTCATAGGACC | 
| Synonyms | AML3; CBFA1; CCD; CCD1; OSF-2; OSF2; PEA2aA; PEBP2A1; PEBP2A2; PEBP2aA; PEBP2aA1 | 
| Quality Control | The primer mix has been tested to generate satisfactory qPCR data on ABI 7900HT by using the following PCR program: Stage 1: Activation: 50 °C for 2 min; Stage 2: pre-soak:95 °C for 10 min; Stage 3: Denaturation: 95 °C for 15 sec, Annealing: 60°C for 1 min; Stage 4: Melting curve: 95°C for 15 sec, 60°C for 15 sec, 95°C for 15 sec. | 
| Storage & Stability | Store at -20°C. | 
Citations (5)
| The use of this Gene Expression has been cited in the following citations: | 
|---|
| Osteoinductive PolyHIPE Foams as Injectable Bone Grafts
                                                ,Robinson, J;McEnery, M;Pearce, H;Whitely, M;Munoz-Pinto, D;Hahn, M;Li, H;Sears, N;Cosgriff-Hernandez, E;,
                                                Tissue Eng Part A
                                                ,PubMed ID 26739120
                                                [RUNX2] | 
| Evaluation of the osteoinductive capacity of polydopamine-coated poly (e-caprolactone) diacrylate shape memory foams
                                                ,Erndt-Marino, JD;Munoz-Pinto, DJ;,
                                                ACS Biomaterials science and engineering
                                                
                                                [RUNX2] | 
| MicroRNA-138 Inhibits Periodontal Progenitor Differentiation under Inflammatory Conditions
                                                ,Zhou, X;Luan, X;Chen, Z;Francis, M;Gopinathan, G;Li, W;Lu, X;Li, S;Wu, C;Diekwisch, TG;,
                                                J. Dent. Res.
                                                ,PubMed ID 26518300
                                                [RUNX2] | 
| A bioactive “self-fitting” shape memory polymer (SMP) scaffold with potential to treat cranio-maxillofacial (CMF) bone defects
                                                ,Zhang, D;George, OJ;Petersen, KM;,
                                                Acta biomaterialia July 2014
                                                
                                                [RUNX2] | 
| A bioactive self-fitting shape memory polymer (SMP) scaffold with potential to treat cranio-maxillofacial (CMF) bone defects
                                                ,Zhang, D;George, OJ;Petersen, KM;Jimenez-Vergara, AC;Hahn, MS;Grunlan, MA;,
                                                Acta Biomater July 2014
                                                ,PubMed ID 25063999
                                                [RUNX2] | 
Documents
| FAQs | 
Resources
| 基因表达相关资源 | 


 
        