p16INK4A (CDKN2A) Human qPCR Primer Pair (NM_058195)
CNY 1140.00
| Cited in 1 publication. | 
Product images
 
                    
                
                                                
                                                
                                                
                                                    CNY 1999.00 
                                                    
                                                    CNY 2700.00
                                                
                                            
                                                
                                                
                                                
                                                    CNY 1800.00 
                                                    
                                                    CNY 4180.00
                                                
                                            
CNY 2710.00
                                                
                                                
                                                
                                                    CNY 2400.00 
                                                    
                                                    CNY 3705.00
                                                
                                            
                                                
                                                
                                                
                                                    CNY 3600.00 
                                                    
                                                    CNY 5130.00
                                                
                                            
                                                
                                                
                                                
                                                    CNY 1320.00 
                                                    
                                                    CNY 3990.00
                                                
                                            
Specifications
| Product Data | |
| Gene ID | 1029 | 
| Forward Sequence | CTCGTGCTGATGCTACTGAGGA | 
| Reverse Sequence | GGTCGGCGCAGTTGGGCTCC | 
| Synonyms | ARF; CDK4I; CDKN2; CMM2; INK4; INK4A; MLM; MTS-1; MTS1; P14; P14ARF; P16; P16-INK4A; P16INK4; P16INK4A; P19; P19ARF; TP16 | 
| Quality Control | The primer mix has been tested to generate satisfactory qPCR data on ABI 7900HT by using the following PCR program: Stage 1: Activation: 50 °C for 2 min; Stage 2: pre-soak:95 °C for 10 min; Stage 3: Denaturation: 95 °C for 15 sec, Annealing: 60°C for 1 min; Stage 4: Melting curve: 95°C for 15 sec, 60°C for 15 sec, 95°C for 15 sec. | 
| Storage & Stability | Store at -20°C. | 
Citations (1)
| The use of this Gene Expression has been cited in the following citations: | 
|---|
| DCAF1 regulates Treg senescence via the ROS axis during immunological aging
                                                ,null,
                                                The Journal of Clinical Investigation
                                                ,PubMed ID 32730228
                                                [CDKN2A] | 
Documents
| FAQs | 
Resources
| 基因表达相关资源 | 


 
        