NLRP3 Human qPCR Primer Pair (NM_004895)
CNY 1140.00
| Cited in 7 publications. |
Product images
CNY 7216.00
CNY 2710.00
CNY 7424.00
CNY 9690.00
CNY 10360.00
CNY 7216.00
CNY 10752.00
CNY 10752.00
Specifications
| Product Data | |
| Gene ID | 114548 |
| Forward Sequence | GGACTGAAGCACCTGTTGTGCA |
| Reverse Sequence | TCCTGAGTCTCCCAAGGCATTC |
| Synonyms | AGTAVPRL; AII; AVP; C1orf7; CIAS1; CLR1.1; DFNA34; FCAS; FCAS1; FCU; KEFH; MWS; NALP3; PYPAF1 |
| Quality Control | The primer mix has been tested to generate satisfactory qPCR data on ABI 7900HT by using the following PCR program: Stage 1: Activation: 50 °C for 2 min; Stage 2: pre-soak:95 °C for 10 min; Stage 3: Denaturation: 95 °C for 15 sec, Annealing: 60°C for 1 min; Stage 4: Melting curve: 95°C for 15 sec, 60°C for 15 sec, 95°C for 15 sec. |
| Storage & Stability | Store at -20°C. |
Citations (7)
| The use of this Gene Expression has been cited in the following citations: |
|---|
|
Stress increases blood beta‐hydroxybutyrate levels and prefrontal cortex NLRP3 activity jointly in a rodent model, et al. Stress increases blood beta‐hydroxybutyrate levels and prefrontal cortex NLRP3 activity jointly in a rodent model
,null,
Neuropsychopharmacology Reports
,PubMed ID 33609086
[NLRP3]
|
|
Activation of NLRP3 by uropathogenic Escherichia coli is associated with IL-1β release and regulation of antimicrobial properties in human neutrophils
,Demirel, I;Persson, A;Brauner, A;Särndahl, E;Kruse, R;Persson, K;,
Scientific reports
,PubMed ID 33318544
[NLRP3]
|
|
Rhabdomyolysis-Induced AKI Was Ameliorated in NLRP3 KO Mice via Alleviation of Mitochondrial Lipid Peroxidation in Renal Tubular Cells
,null,
International Journal of Molecular Sciences
,PubMed ID 33202867
[NLRP3]
|
|
Inflammasome-Independent Role of NLRP3 Mediates Mitochondrial Regulation in Renal Injury
,null,
Frontiers in Immunology
,PubMed ID 30483252
[NLRP3]
|
|
NOX4-dependent fatty acid oxidation promotes NLRP3 inflammasome activation in macrophages
,null,
Nature medicine
,PubMed ID 27455510
[NLRP3]
|
|
HIV and HCV Activate the Inflammasome in Monocytes and Macrophages via Endosomal Toll-Like Receptors without Induction of Type 1 Interferon
,null,
PLoS Pathogens
,PubMed ID 24788318
[NLRP3]
|
|
Francisella tularensis Reveals a Disparity between Human and Mouse NLRP3 Inflammasome Activation *
,null,
The Journal of Biological Chemistry
,PubMed ID 21930705
[NLRP3]
|
Documents
| FAQs |
Resources
| 基因表达相关资源 |
