ATG16L1 Human qPCR Primer Pair (NM_030803)

CAT#: HP232946

qSTAR qPCR primer pairs against Homo sapiens gene ATG16L1



CNY 1140.00


货期*
5周

规格
    • 200 reactions

Cited in 3 publications.

Product images

推荐一起购买 (9)
ATG16L1 mouse monoclonal antibody,clone OTI5A2
    • 100 ul

CNY 1999.00
CNY 2700.00


ATG16L1 (Myc-DDK-tagged)-Human ATG16 autophagy related 16-like 1 (S. cerevisiae) (ATG16L1), transcript variant 1
    • 10 ug

CNY 4520.00
CNY 5320.00


First Strand cDNA Synthesis Kit (11801-100)
    • 100 reactions

CNY 4180.00


A ready-to-use mix for SYBR Green qPCR, containing ROX reference and suitable for all qPCR instruments without adjusting the concentration of ROX.
    • 4 x 1.25 ml (500 rxns/20ul reaction)

CNY 2710.00


First Strand cDNA Synthesis Kit (11801-025)
    • 25 reactions

CNY 1330.00


ATG16L1 (Myc-DDK-tagged)-Human ATG16 autophagy related 16-like 1 (S. cerevisiae) (ATG16L1), transcript variant 4
    • 10 ug

CNY 3896.00
CNY 4560.00


ATG16L1 (Myc-DDK-tagged)-Human ATG16 autophagy related 16-like 1 (S. cerevisiae) (ATG16L1), transcript variant 3
    • 10 ug

CNY 3656.00
CNY 3990.00


ATG16L1 (Myc-DDK-tagged)-Human ATG16 autophagy related 16-like 1 (S. cerevisiae) (ATG16L1), transcript variant 2
    • 10 ug

CNY 4376.00
CNY 5130.00


ATG16L1 (Myc-DDK-tagged)-Human ATG16 autophagy related 16-like 1 (S. cerevisiae) (ATG16L1), transcript variant 5
    • 10 ug

CNY 3656.00
CNY 4280.00

Specifications

Product Data
Gene ID 55054
Forward Sequence CTACGGAAGAGAACCAGGAGCT
Reverse Sequence CTGGTAGAGGTTCCTTTGCTGC
Synonyms APG16L; ATG16A; ATG16L; IBD10; WDR30
Quality Control The primer mix has been tested to generate satisfactory qPCR data on ABI 7900HT by using the following PCR program: Stage 1: Activation: 50 °C for 2 min; Stage 2: pre-soak:95 °C for 10 min; Stage 3: Denaturation: 95 °C for 15 sec, Annealing: 60°C for 1 min; Stage 4: Melting curve: 95°C for 15 sec, 60°C for 15 sec, 95°C for 15 sec.
Storage & Stability Store at -20°C.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Citations (3)

Documents

Customer Reviews 
Loading...