TRK fused gene (TFG) Human qPCR Primer Pair (NM_006070)
CNY 1140.00
Cited in 6 publications. |
Product images

CNY 2710.00
CNY 3656.00
CNY 5320.00
CNY 1999.00
CNY 2700.00
Specifications
Product Data | |
Gene ID | 10342 |
Forward Sequence | GAGAACCAGGACCTTCCACCAA |
Reverse Sequence | GCTGCCATAACCTGAGTAGACTG |
Synonyms | HMSNP; SPG57; TF6; TRKT3 |
Quality Control | The primer mix has been tested to generate satisfactory qPCR data on ABI 7900HT by using the following PCR program: Stage 1: Activation: 50 °C for 2 min; Stage 2: pre-soak:95 °C for 10 min; Stage 3: Denaturation: 95 °C for 15 sec, Annealing: 60°C for 1 min; Stage 4: Melting curve: 95°C for 15 sec, 60°C for 15 sec, 95°C for 15 sec. |
Storage & Stability | Store at -20°C. |
Citations (6)
The use of this Gene Expression has been cited in the following citations: |
---|
MicroRNA-138 Inhibits Periodontal Progenitor Differentiation under Inflammatory Conditions
,null,
Journal of Dental Research
,PubMed ID 26518300
[TFG]
|
MicroRNA-99 Family Targets AKT/mTOR Signaling Pathway in Dermal Wound Healing
,null,
PLoS ONE
,PubMed ID 23724047
[TFG]
|
Down-regulation of the microRNA-99 family members in head and neck squamous cell carcinoma
,null,
Oral oncology
,PubMed ID 22425712
[TFG]
|
Identification and experimental validation of G protein alpha inhibiting activity polypeptide 2 (GNAI2) as a microRNA-138 target in tongue squamous cell carcinoma
,null,
Human genetics
,PubMed ID 21079996
[TFG]
|
MicroRNA-7 targets IGF1R (insulin-like growth factor 1 receptor) in tongue squamous cell carcinoma cells
,null,
The Biochemical journal
,PubMed ID 20819078
[TFG]
|
Down-regulation of the Rho GTPase signaling pathway is involved in the microRNA-138 mediated inhibition of cell migration and invasion in tongue squamous cell carcinoma
,null,
International journal of cancer. Journal international du cancer
,PubMed ID 20232393
[TFG]
|
Documents
FAQs |
Resources
基因表达相关资源 |