SARS-CoV-2 ORF6 Gene cDNA Clone (Native Sequence)
CAT#: VC202560
- TrueORF®
Native cDNA clone for SARS-CoV-2 ORF6 protein [Severe acute respiratory syndrome coronavirus 2], YP_009724394
View other clones from "SARS-CoV-2" (41)
Need custom modification / cloning service?
Get a free quote
CNY 3,800.00
Cited in 13 publications. |
Product images
Specifications
Product Data | |
Vector | pUCminusMCS |
E. coli Selection | Ampicillin |
Mammalian Cell Selection | None |
Sequence Data |
>The Viral ORF clone VC202560 represents NCBI reference of YP_009724394 for cloning vector
Blue=ORF Red=Cloning site Green=Tag(s) GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC ATGTTTCATCTCGTTGACTTTCAGGTTACTATAGCAGAGATATTACTAATTATTATGAGGACTTTTAAA GTTTCCATTTGGAATCTTGATTACATCATAAACCTCATAATTAAAAATTTATCTAAGTCACTAACTGAG AATAAATATTCTCAATTAGATGAAGAGCAACCAATGGAGATTGATTAA |
ACCN | NC_045512 |
ORF Size | 186 bp |
OTI Annotation | This clone was engineered to express the complete ORF. Expression varies depending on the nature of the gene. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NC_045512.2, YP_009724394 |
RefSeq ORF | 186 bp |
MW | 7.3 kDa |
Citations (13)
The use of this cDNA Clones has been cited in the following citations: |
---|
Hair cell α9α10 nicotinic acetylcholine receptor functional expression regulated by ligand binding and deafness gene products
,null,
Proceedings of the National Academy of Sciences of the United States of America
,PubMed ID 32929005
[ORF6]
|
The Response to Burn Injury in Mice with Human Hemato-Lymphoid Systems
,null,
Annals of surgery
,PubMed ID 25575256
[ORF6]
|
A Polymorphic Variant in p19Arf Confers Resistance to Chemically Induced Skin Tumors by Activating the p53 Pathway.
,null,
The Journal of investigative dermatology
,PubMed ID 30684556
[ORF6]
|
Mismatched effects of receptor interacting protein kinase-3 on hepatic steatosis and inflammation in non-alcoholic fatty liver disease
,null,
World Journal of Gastroenterology
,PubMed ID 30622377
[ORF6]
|
Loss of NLRX1 exacerbates neural tissue damage and NF-κB Signaling following brain injury
,null,
Journal of immunology (Baltimore, Md. : 1950)
,PubMed ID 28993512
[ORF6]
|
Deleting an Nr4a1 super-enhancer subdomain ablates Ly6Clow monocytes while preserving macrophage gene function
,null,
Immunity
,PubMed ID 27814941
[ORF6]
|
Insulin and IGF-1 receptors regulate FoxO-mediated signaling in muscle proteostasis
,null,
The Journal of Clinical Investigation
,PubMed ID 27525440
[ORF6]
|
A Point Mutation in DNA Polymerase β (POLB) Gene Is Associated with Increased Progesterone Receptor (PR) Expression and Intraperitoneal Metastasis in Gastric Cancer
,null,
Journal of Cancer
,PubMed ID 27471563
[ORF6]
|
Structurally similar estradiol analogs uniquely alter the regulation of intracellular signaling pathways
,null,
Journal of Molecular Endocrinology
,PubMed ID 23132914
[ORF6]
|
5-Aza-2'-deoxycytidine and interleukin-1 cooperate to regulate matrix metalloproteinase-3 gene expression.
,null,
International journal of cancer
,PubMed ID 21170958
[ORF6]
|
Distinct Amino Termini of Two Human HCS Isoforms Influence Biotin Acceptor Substrate Recognition *
,null,
The Journal of Biological Chemistry
,PubMed ID 19740736
[ORF6]
|
Downregulation of Connective Tissue Growth Factor by Three-Dimensional Matrix Enhances Ovarian Carcinoma Cell Invasion
,null,
International journal of cancer. Journal international du cancer
,PubMed ID 19382180
[ORF6]
|
Motility Related Actinin Alpha-4 Is Associated with Advanced and Metastatic Ovarian Carcinoma
,null,
Laboratory investigation; a journal of technical methods and pathology
,PubMed ID 18362906
[ORF6]
|
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
VC102555 | Myc-DDK-tagged ORF clone for SARS-CoV-2 nucleocapsid phosphoprotein [Severe acute respiratory syndrome coronavirus 2], YP_009724397 |
CNY 3,656.00 |
|
VC102556 | Myc-DDK-tagged ORF clone for SARS-CoV-2 surface glycoprotein extracellular domain [Severe acute respiratory syndrome coronavirus 2], YP_009724390 |
CNY 8,320.00 |
|
VC102557 | Myc-DDK-tagged ORF clone for SARS-CoV-2 surface glycoprotein [Severe acute respiratory syndrome coronavirus 2], codon optimized for human cell expression, YP_009724390. Note: ORF is codon optimized |
CNY 8,864.00 |
|
VC102558 | Myc-DDK-tagged ORF clone for SARS-CoV-2 ORF3a protein [Severe acute respiratory syndrome coronavirus 2], codon optimized for human cell expression, YP_009724391. Note: ORF is codon optimized |
CNY 2,400.00 |
|
VC102559 | Myc-DDK-tagged ORF clone for SARS-CoV-2 Membrane Glycoprotein [Severe acute respiratory syndrome coronavirus 2], codon optimized for human cell expression, YP_009724393. Note: ORF is codon optimized |
CNY 2,400.00 |
|
VC102560 | Myc-DDK-tagged ORF clone for SARS-CoV-2 ORF6 protein [Severe acute respiratory syndrome coronavirus 2], codon optimized for human cell expression, YP_009724394 |
CNY 3,800.00 |
|
VC102561 | Myc-DDK-tagged ORF clone for SARS-CoV-2 ORF7a protein [Severe acute respiratory syndrome coronavirus 2], codon optimized for human cell expression, YP_009724395 |
CNY 3,800.00 |
|
VC102562 | Myc-DDK-tagged ORF clone for SARS-CoV-2 ORF8 protein [Severe acute respiratory syndrome coronavirus 2], codon optimized for human cell expression, YP_009724396 |
CNY 1,200.00 |
|
VC102563 | Myc-DDK-tagged ORF clone for SARS-CoV-2 Nucleocapsid Phosphoprotein [Severe acute respiratory syndrome coronavirus 2], codon optimized for human cell expression, YP_009724397 |
CNY 3,656.00 |
|
VC102564 | Myc-DDK-tagged ORF clone for SARS-CoV-2 ORF10 protein [Severe acute respiratory syndrome coronavirus 2], codon optimized for human cell expression, YP_009725255 |
CNY 3,800.00 |
|
VC102565 | Myc-DDK-tagged ORF clone for SARS-CoV-2 Envelop Protein [Severe acute respiratory syndrome coronavirus 2], codon optimized for human cell expression, YP_009724392. Note: ORF is codon optimized |
CNY 1,200.00 |
|
VC102566 | Myc-DDK-tagged ORF clone for SARS-CoV-2 surface glycoprotein [Severe acute respiratory syndrome coronavirus 2], YP_009724390 |
CNY 8,864.00 |
|
VC102567 | Myc-DDK-tagged ORF clone for SARS-CoV-2 ORF3a protein [Severe acute respiratory syndrome coronavirus 2], YP_009724391 |
CNY 2,400.00 |
|
VC102568 | Myc-DDK-tagged ORF clone for SARS-CoV-2 Membrane Glycoprotein [Severe acute respiratory syndrome coronavirus 2], YP_009724393 |
CNY 2,400.00 |
|
VC102569 | Myc-DDK-tagged ORF clone for SARS-CoV-2 ORF6 protein [Severe acute respiratory syndrome coronavirus 2], YP_009724394 |
CNY 1,200.00 |
|
VC102570 | Myc-DDK-tagged ORF clone for SARS-CoV-2 ORF7a protein [Severe acute respiratory syndrome coronavirus 2], YP_009724395 |
CNY 1,200.00 |
|
VC102571 | Myc-DDK-tagged ORF clone for SARS-CoV-2 ORF8 protein [Severe acute respiratory syndrome coronavirus 2], YP_009724396 |
CNY 1,200.00 |
|
VC102572 | Myc-DDK-tagged ORF clone for SARS-CoV-2 ORF10 protein [Severe acute respiratory syndrome coronavirus 2], YP_009725255 |
CNY 1,200.00 |
|
VC102573 | Myc-DDK-tagged ORF clone for SARS-CoV-2 Envelop Protein [Severe acute respiratory syndrome coronavirus 2], YP_009724392 |
CNY 1,200.00 |
|
VC102574 | mRFP-tagged ORF clone for SARS-CoV-2 NSP4 [Severe acute respiratory syndrome coronavirus 2], YP_009725300.1 |
CNY 3,800.00 |
|
VC102575 | mRFP-tagged ORF clone for SARS-CoV-2 NSP5 [Severe acute respiratory syndrome coronavirus 2], YP_009725301.1 |
CNY 2,400.00 |
|
VC102576 | mRFP-tagged ORF clone for SARS-CoV-2 NSP6 [Severe acute respiratory syndrome coronavirus 2], YP_009725302.1 |
CNY 2,400.00 |
|
VC102577 | mRFP-tagged ORF clone for SARS-CoV-2 NSP7 [Severe acute respiratory syndrome coronavirus 2], YP_009725303.1 |
CNY 1,200.00 |
|
VC102578 | mRFP-tagged ORF clone for SARS-CoV-2 NSP8 [Severe acute respiratory syndrome coronavirus 2], YP_009725304.1 |
CNY 2,400.00 |
|
VC102579 | mRFP-tagged ORF clone for SARS-CoV-2 NSP9 [Severe acute respiratory syndrome coronavirus 2], YP_009725305.1 |
CNY 1,200.00 |
|
VC102580 | mRFP-tagged ORF clone for SARS-CoV-2 NSP10 [Severe acute respiratory syndrome coronavirus 2], YP_009725306.1 |
CNY 1,200.00 |
|
VC102581 | mRFP-tagged ORF clone for SARS-CoV-2 NSP14 [Severe acute respiratory syndrome coronavirus 2], YP_009725309.1 |
CNY 3,800.00 |
|
VC102582 | mRFP-tagged ORF clone for SARS-CoV-2 ORF3a [Severe acute respiratory syndrome coronavirus 2], YP_009724391.1 |
CNY 2,400.00 |
|
VC102583 | mRFP-tagged ORF clone for SARS-CoV-2 M protein [Severe acute respiratory syndrome coronavirus 2], YP_009724393.1 |
CNY 2,400.00 |
|
VC102584 | mRFP-tagged ORF clone for SARS-CoV-2 ORF9b [Severe acute respiratory syndrome coronavirus 2], YP_009724397.2 |
CNY 1,200.00 |
|
VC102585 | mRFP-tagged ORF clone for SARS-CoV-2 ORF9c [Severe acute respiratory syndrome coronavirus 2], YP_009724397.2 |
CNY 1,200.00 |
|
VC102586 | mRFP-tagged ORF clone for SARS-CoV-2 ORF10 [Severe acute respiratory syndrome coronavirus 2], YP_009725255.1 |
CNY 1,200.00 |
|
VC102587 | Myc-DDK-tagged ORF clone for SARS-CoV-2 surface glycoprotein mutant (D614G) [Severe acute respiratory syndrome coronavirus 2], YP_009724390 |
CNY 8,864.00 |
|
VC202557 | Native cDNA clone for SARS-CoV-2 surface glycoprotein [Severe acute respiratory syndrome coronavirus 2], YP_009724390 |
CNY 8,872.00 |
|
VC202558 | Native cDNA clone for SARS-CoV-2 ORF3a protein [Severe acute respiratory syndrome coronavirus 2], YP_009724391 |
CNY 2,400.00 |
|
VC202559 | Native cDNA clone for SARS-CoV-2 Membrane Glycoprotein [Severe acute respiratory syndrome coronavirus 2], YP_009724393 |
CNY 2,400.00 |
|
VC202561 | Native cDNA clone for SARS-CoV-2 ORF7a protein [Severe acute respiratory syndrome coronavirus 2], YP_009724395 |
CNY 3,800.00 |
|
VC202562 | Native cDNA clone for SARS-CoV-2 ORF8 protein [Severe acute respiratory syndrome coronavirus 2], YP_009724396 |
CNY 3,800.00 |
|
VC202563 | Native cDNA clone for SARS-CoV-2 Nucleocapsid Phosphoprotein [Severe acute respiratory syndrome coronavirus 2], YP_009724397 |
CNY 3,656.00 |
|
VC202564 | Native cDNA clone for SARS-CoV-2 ORF10 protein [Severe acute respiratory syndrome coronavirus 2], YP_009725255 |
CNY 3,800.00 |
|
VC202565 | Native cDNA clone for SARS-CoV-2 Envelop Protein [Severe acute respiratory syndrome coronavirus 2], YP_009724392 |
CNY 3,800.00 |