Vimentin (VIM) Human qPCR Primer Pair (NM_003380)
CNY 1140.00
| Cited in 5 publications. | 
Product images
 
                    
                CNY 2710.00
                                                
                                                
                                                
                                                    CNY 1999.00 
                                                    
                                                    CNY 2700.00
                                                
                                            
Specifications
| Product Data | |
| Gene ID | 7431 | 
| Forward Sequence | AGGCAAAGCAGGAGTCCACTGA | 
| Reverse Sequence | ATCTGGCGTTCCAGGGACTCAT | 
| Quality Control | The primer mix has been tested to generate satisfactory qPCR data on ABI 7900HT by using the following PCR program: Stage 1: Activation: 50 °C for 2 min; Stage 2: pre-soak:95 °C for 10 min; Stage 3: Denaturation: 95 °C for 15 sec, Annealing: 60°C for 1 min; Stage 4: Melting curve: 95°C for 15 sec, 60°C for 15 sec, 95°C for 15 sec. | 
| Storage & Stability | Store at -20°C. | 
Citations (5)
| The use of this Gene Expression has been cited in the following citations: | 
|---|
| MicroRNA-15a Carried by Mesenchymal Stem Cell-Derived Extracellular Vesicles Inhibits the Immune Evasion of Colorectal Cancer Cells by Regulating the KDM4B/HOXC4/PD-L1 Axis
                                                ,null,
                                                Frontiers in Cell and Developmental Biology
                                                ,PubMed ID 33732698
                                                [VIM] | 
| Distinct Ring1b complexes defined by DEAD-box helicases and EMT transcription factors synergistically enhance E-cadherin silencing in breast cancer
                                                ,Wang, Y;Sun, Y;Shang, C;Chen, L;Chen, H;Wang, D;Zeng, X;,
                                                Cell death & disease
                                                ,PubMed ID 33608512
                                                [VIM] | 
| HDAC6 plays a non-canonical role in the regulation of anti-tumor immune responses, dissemination, and invasiveness of breast cancer
                                                ,Banik, D;Noonepalle, S;Hadley, M;Palmer, E;Gracia-Hernandez, M;Zevallos-Delgado, C;Manhas, N;Simonyan, H;Young, CN;Popratiloff, A;Chiappinelli, KB;Fernandes, R;Sotomayor, EM;Villagra, A;,
                                                Cancer Res.
                                                ,PubMed ID 32605998
                                                [VIM] | 
| Loss of GFAT1 promotes epithelial-to-mesenchymal transition and predicts unfavorable prognosis in gastric cancer
                                                ,Duan, F;Jia, D;Zhao, J;Wu, W;Min, L;Song, S;Wu, H;Wang, L;Wang, H;Ruan, Y;Gu, J;,
                                                Oncotarget
                                                ,PubMed ID 27509259
                                                [VIM] | 
| Identification of proteins related to epigenetic regulation in the malignant transformation of aberrant karyotypic human embryonic stem cells by quantitative proteomics
                                                ,Sun, Y;Yang, Y;Zeng, S;Tan, Y;Lu, G;Lin, G;,
                                                PLoS ONE, Jan 2014.
                                                ,PubMed ID 24465727
                                                [VIM] | 
Documents
| FAQs | 
Resources
| 基因表达相关资源 | 

 热销推荐
热销推荐 
        